Korean J Intern Med > Volume 16(4); 2001 > Article
Park, Kim, Hong, Jung, Park, Kim, and Yoo: Expression of Mucosal Cyto-Chemokine mRNAs in Patients with Helicobacter pylori Infection

Abstract

Background

Helicobacter pylori-induced destruction of the gastroduodenal mucosal barrier is initiated with mucosal infiltration of inflammatory cells. Cytokines and chemokines have been suggested to play important roles in the migration and activation of these inflammatory cells into the mucosa. The present study aimed to investigate expression rates of cyto-chemokine mRNAs using gastric mucosal biopsy specimens.

Methods

In 98 patients infected with Helicobacter pylori, mucosal mRNA expression rates of cytokines (IL-1β, IL-6, and IL-10), C-C chemokines (macrophage inflammatory protein 1α [MIP-1α), and macrophage inflammatory protein 10 [MIP-1α], monocyte chemotactic and activating factor (MCAF), regulated on activation, normal T cell expressed and presumably secreted [RANTES] and C-X-C chemokines (IL-8 and growth regulated α [GRO-α]) were examined using reverse transcription polymerase chain reaction (RT-PCR).

Results

The expression rates of mRNA for IL-8, GRO-α, MIP-1α and RANTES were significantly more increased in H. pylori-positive patients than in H. pylori-negative patients. However, the expressions of IL-1β, IL-6 and IL-10 mRNA were statistically not different between two groups. After eradication of H. pylori, expressions of mRNA for three cytokines (IL-1β, IL-6 and IL-10), four C-C chemokines (MIP-1α, MIP-1β, MCAF and RANTES) and two C-X-C chemokines (IL-8 and GRO-α) were significantly decreased.

Conclusion

These results suggest that C-X-C chemokines and some C-C chemokines play important roles in H. pylori-associated peptic ulcer diseases.

INTRODUCTION

Helicobacter pylori (H. pylori) is recognized as a major cause of chronic gastritis, peptic ulcer diseases, gastric adenocarcinoma and gastric MALToma. H. pylori-induced destruction of the gastroduodenal mucosal barrier is initiated with mucosal infiltration of inflammatory cells and H. pylori-associated gastritis begins as an acute neutrophilic inflammatory response which, in the majority of individuals, progress to chronic gastritis. Bacterial eradication results in significant reduction in these inflammatory cell infiltrations in the gastric mucosa and healing of the gastritis. The migration and activation of inflammatory cells into the mucosa are thought to be related to the expression of various cytokines18). Of these, IL-8 is now proved to be a definite chemoattractant and activation signal for neutrophils in acute as well as more prolonged H. pylori infection25,7,8).
Chemotactic cytokines or “chemokines” are classified into two major families on the basis of the arrangement of the first two of four conserved cysteine residues. Chemokine α or C-X-C chemokine is located on chromosome 4 (q12–21) and the first two of their cysteine groups are separated by one amino acid. This C-X-C chemokine group includes IL-8, melanoma growth-stimulating activity/growth regulated (MGSA/GRO), platelet factor 4 (PF4), β thrombo-globulin (βTG), IP-10 and ENA-78. The chemokine β or C-C chemokine group is located on chromosome 17 (q11–32), has no intervening amino acid between the first two cysteines and includes macrophage chemotactic and activating factor (MCAF/MCP-1), regulated on activation, normal T cell expressed and presumably secreted (RANTES), LD-78 (also known as human MIP-1α, ACT-2 or huMIP-1β) and I-309. In general, C-C chemokines mainly show chemotactic activities for neutrophils but not monocytes, whereas C-X-C chemokines show chemotactic activities for monocytes and lymphocytes but have little effect on neutrophils9).
The present study aimed to clarify any relationship between H. pylori infection and expression rates of cyto-chemokine mRNAs in the gastric mucosa by using the reverse transcription polymerase chain reaction (RT-PCR) method.

MATERIALS AND METHODS

Population studied

This study was prospectively performed at the Department of Internal Medicine, Chung-Ang University, Yong-San Hospital from June 1997 to June 1999.
The study population was made up of 98 patients (74 males and 24 females; mean age, 45.7 years; range 22–86) with endoscopically and histologically confirmed benign gastric (GU, 29 patients) or duodenal ulcers (DU, 69 patients) who were infected with H. pylori. The control group consisted of 18 peptic ulcer patients (10 GU patients and 8 DU patients) who were not infected with H. pylori. Patients were excluded if they had a history of gastric surgery, active gastrointestinal bleeding, exposure to steroids or NSAIDs, H2-receptor antagonists, proton pump inhibitor, or antimicrobial agents within 30 days prior to the study. Patients with any other chronic illness were also excluded.

Methods

Endoscopic procedure and the diagnosis of H. pylori infection

Gaslroscopic examination was performed and the endoscopic findings were recorded. Eight mucosal biopsy specimens were obtained from each patient: one biopsy specimen each from the gastric antrum within 2 cm proximal to the pylorus and from the gastric midbody were submitted for histological evaluation by a single pathologist who was unaware of the PCR results. Histological confirmation of H. pylori infection was done by the Warthin-Starry silver staining of individual mucosal specimen. Microaerophilic culture under 37°C and rapid urease test were performed on each patient. The remaining one biopsy specimen each from the gastric antrum and midbody were frozen at −70°C for RNA extraction and RT-PCR to detect the presence of H. pylori genes and cyto-chemokine mRNAs.
Patients were classified as H. pylori-positive when the culture was positive or if at least two of the three examinations, that is, the rapid urease test, histological examination and presence of the 16S-rRNA, gave positive results for H. pylori. Both GU and DU patients infected with H. pylori were treated with omeprazole (10 mg twice daily), amoxycillin (1,000 mg twice daily) and clarithromycin (500 mg twice daily), for the first two weeks. Thereafter, ranitidine (150 mg twice daily) and antacid were given for four or six more weeks to the GU patients. Four weeks after cessation of treatment, the patients were endoscoped again and biopsy specimens were taken as before. Successful eradication of H. pylori was determined if all of the above mentioned test results were negative.

Preparation of RNA and cDNA for measurement of H. pylori-specific, 16S-rRNA and cyto-chemokine mRNA in gastric biopsy specimens

Individual gastric biopsy specimens were placed in a sterile vial and stored at −70°C until they were used for RNA extraction for RT-PCR. Samples were homogenized with tissue homogenizer (Bio-Spec, Bartlesville, OK, USA) and total RNA was extracted and purified by the guanidiumthiocyanate-phenol-chloroform method using ULTRA™-II RNA Resin Purification System kit (Biotecx Lab., Inc. Houston, TX, USA) in 500 μL of homogenization buffer. Individual cDNA was synthesized by reverse transcription of RNA using Perkin Elmer GenAmp RNA PCR kit (Applied Biosystems Division, Roche, Foster City, CA, USA).

PCR amplification reaction

Detection of H. pylori 16S-rRNA of cDNA from gastric mucosal biposy specimens was performed by PCR amplification by using oligonucleotide primers described in detail previously10). The sense and antisense primers specific for each cyto-chemokine are shown in Table 1. Amplification reaction of each cyto-chemokine was carried out in a total volume of 100 μL containing 10 μL of cDNA, 8 μL of 10x PCR reaction buffer (50 mM KCl, 1 mM Tris-HCl [pH 8.3]), 2.0 mM MgCl2, 200 μM for each of dATP, dCTP, dGTP, and dTTP, and 2.5 U AmpliTaq DNA polymerase (Perkin Elmer Citus, Foster, CA, USA). Primers of each cyto-chemokine were used as a final concentration of 0.1 μM. Each reaction mixture was overlayed with mineral oil and was amplified for 35 cycles, each of which consisted of 1 minute at 95°C for denaturation, 1 minute at 60°C for annealing and 1 minute at 72°C for extension with final extension of 7 minutes at 72C. Fifteen microliter aliquots of each PCR product were analyzed using electrophoresis on 1.5% agarose gel containing ethidium bromide (Sigma-Aldrich, St. Louis, MO, USA) and the bands were examined under UV light for the presence of the amplified DNA.

Statistical analysis

Pearson chi-square test and paired t-test were used to determine the significance of differences between two groups with a difference in p value less than 0.05 being considered significant.

RESULTS

Relationship between H. pylori infection and expression of mRNAs for cyto-chemokines

Of the ninety-eight patients infected with H. pyiori, 48 patients (GU 10 and DU 38) were not followed up. While 35 patients (GU 16 and DU 19) attained successful eradication of H. pylori after the two-weeks’ therapy of antibacterial drugs, the remaining 15 patients (GU 3 and DU 12 patients) did not.
H. pylori infection was associated with significantly increased rates of expression of mRNA for IL-8, GRO-α, MIP-1α and RANTES. However, there was no difference in the expression rates of IL-1β, IL-6, IL-10, MIP-1β or MACF mRNA between H. pylori-positive patients and H. pylori-negative control patients (p >0.05), (Table 2, 3). There was no significant difference in cyto-chemokine mRNA expression rates between patients with GU and those with DU (Table 3).

Effect of H. pylori eradication on expression rates of cyto-chemokines

Expression of mRNA of three cytokines, two C-X-C chemokines, four C-C chemokines and mucosal concentrations of IL-1β, IL-6, IL-8, GRO-α and RANTES protein in patients infected with H. pylori were compared before and after the eradication therapy.
Fifty patients were treated for bacterial eradication. Nineteen patients had GU and 31 had DU. Of 50 patients, 35 patients became H. pylori-negative and 15 patients were still positive for H. pylori after eradication therapy.
Patients with successful eradication of H. pylori showed significant decrease in positive rates of mRNA expression of all cyto-chemokines (Table 4). However, patients without H. pylori eradication with antibiotic therapy did not show any change in expression rates for mRNAs of cyto-chemokines except for GRO-α and MIP-1β. The positive rates of GRO-α and MIP-1β mRNA were significantly decreased in spite of persistence of H. pylori after eradication therapy (53.3% to 6.6% and 93.3% to 6.6%, respectively) (Table 4).

DISCUSSION

Several mechanisms are thought to be involved in H. pylori-induced damage of the gastroduodenal mucosa; 1) qualitative and quantitative changes of the mucus layer by bacterial protease, glycosulphatase, phospholipase, urease, toxins and possible pepsin inhibitor11) 2) reduced mucosal hydrophobicity induced by bacterial phospholipase A212) 3) adherence and internalization of epithelial cells by bacterial adhesin from H. pylori1315) and 4) specific humoral and cell-mediated immunologic damages16,17). Bacterial lipopolysaccharide18), heat-shock protein19) and gastric acid inhibitory protein20) also play important roles in breaking the gastroduodenal integrity. The local inflammatory and immune responses seen in H. pylori infection are also thought to cause the breakdown of the integrity of the gastroduodenal mucosal barrier.
A number of inflammatory mediators have been shown to be increased in H. pylori infection. Crabtree et al.1,2) detected higher levels of TNF-α, IL-6 and IL-8 in culture supernatants of H. pylori-infected gastric biopsy specimens than in specimens from uninfected patients. Noach et al.3) also detected increased levels of IL-1β, IL-8 and TNF-α in culture supernatants of antral biopsy specimens from H. pylori-infected patients. Yamaoka et al.7,8,21) also reported similar results.
The present study showed that mRNAs for IL-1β, IL-6 and IL-10 were detected in gastric mucosal biopsy specimens both from H. pylori-positive and H. pylori-negative patients. Although pre-treatment expression rates of mRNAs were not different between the two groups, detection rates of these mRNAs were significantly decreased when H. pylori were successfully eradicated. Our results were not in agreement with those of other studies7,11,21) which showed that expression rates of mRNAs for IL-1β, IL-6 and IL-10 were significantly higher in H. pylori-positive patients than in H. pylori-negative patients. However, the number of H. pylori-negative cases in our study was too small to compare with H. pylori-positive patients (n=18 vs n=98). Further study with a larger number of H. pylori-negative patients is needed in order to verify the exact difference between the two groups.
IL-8 is a potent chemoattractant for neutrophils and T lymphocytes. In response to H. pylori infection, IL-8 is produced from gastric epithelial cells evidenced by direct expression of IL-8 mRNA in these cells and is localized to the epithelial cell layer22,23). The epithelial cells are the first line of mucosal defense against the H. pylori infection and IL-8 acts as a trigger for inflammation. These inflammatory cells then reciprocally produce IL-8 and other cytokines which form the “cytokine network” to induce gastric mucosal inflammation. Our study showed that expression rate of IL-8 mRNA was significantly higher in H. pylori-positive patients than in H. pylori-negative patients and was significantly decreased after successful eradication of H. pylori. Our results were in agreement with those of other studies24,7,8). Another C-X-C chemokine, GRO-α mRNA was also significantly increased in patients with H. pylori infection and decreased in all patients after successful bacterial eradication. Patients without bacterial eradication after treatment also showed decreased rate of detection of GRO-α mRNA. These findings suggest that IL-8 and GRO-α play important roles in H. pylori-associated gastric inflammation.
With regard to C-C chemokines, positive rates of expression of both MIP-1α and RANTES mRNA were significantly more increased in H. pylori-positive patients than in H. pylori-negative patients. MIP-1β and MCAF mRNA were detected in the majority of patients regardless of the presence of H. pylori. When expression rates of MIP-1α, MIP-1β, MACF and RANTES mRNA were compared before and after antibacterial therapy, detection rates of these four C-C chemokine mRNAs were significantly decreased after eradication of H. pylori.
In conclusion, our results support the hypothesis that C-X-C chemokines and some C-C chemokines play important roles in the pathogenesis of gastroduodenal injury in patients infected with H. pylori.

Acknowledgments

The authors wish to acknowledge the financial support of the Korean Research Foundation made in the program year of 1997.

Table 1.
Oligonucleotide primers specific for H. pylori gene and for human cyto-chemokines
Gene and Cyto-chemokine Primer cDNA (bp)
16SrRNA Sense GCTAAGAGATCAGCCTATGTCC 522
Antisense TGGCAATCAGCGTCAGGTAATG
IL-1β Sense ATAAGCCCACTCTACAGCT 443
Antisense ATTGGCCCTGAMGGAGAGA
IL-6 Sense GTACCCCCAGGAGAAGATTC 819
Antisense CAAACTGCATAGCCACTTTC
IL-8 Sense GCTTTCTGATGGMGAGAGC 585
Antisense GGCACAGTGGAACAAGGACT
IL-10 Sense ATGCCCCAAGCTGAGMCCAAGAC 353
Antisense TCTCAAGGGGCTGGGTCAGCTATCCCA
MIP-1α Sense CCTTGCTGTCCTCCTCTGGA 254
Antisense CACTCAGCTCTAGGTCGCYG
MIP-1β Sense TGTCTCTCCTCATGCTAGTA 233
Antisense GTACTCCTGGACCCAGGAT
GROα Sense TTGCAGACCCTGCAGGGAAT 184
Antisense TGGATTTGTCACTGTTCAGC
MCAF Sense CAATAGGAAGATCTCAGTGC 188
Antisense GTGTTCAAGTCTTCGGAGTT
RANTES Sense TGCCTCCCATATTCCTCGG 211
Antisense CTAGCTCATCTCCAAAGA
Table 2.
Relationship between expression of cytokine mRNA and H. pylori infection
H. pylori Infection Diseases No. Studied Cytokines (%)
IL-1β IL-6 IL-10
Absent GU & DU 18 12 (66.7)*  2 (11.1)  1 (5.6)
Present GU 29 21 (71.4) 10 (34.5)  4 (13.8)
DU 69 64 (92.8) 17 (24.6) 21 (30.4)
Total 98 85 (86.7)* 27 (27.6) 25 (43.9)

GU, Gastric ulcer; DU, Duodenal ulcer *, , p > 0.05

Table 3.
Relationship between expression of chemokine mRNA and H. pylori infection
H. pylori Infection Diseases No. Studied C X-C Chemokine (%)
C-C Chemokine(%)
IL-8 GRO-a MIP-1a MIP-10 MCAF RANTES
Absent GU & DU 18  3 (16.7)*  1 (0.6)  3 (16.7) 14 (77.8) 15 (83.3)  3 (16.7)§
Present GU 29 21 (72.4) 22 (75.9) 17 (58.6) 26 (89.7) 19 (65.5) 15 (51.7)
DU 69 55 (79.7) 51 (73.9) 51 (58.6) 50 (72.5) 48 (69.6) 43 (62.3)
Total 98 76 (67.1)* 73 (74.5) 68 (69.6) 76 (77.6) 67 (68.4) 58 (59.2)§

GU, Gastric ulcer; DU, Duodenal ulcer *,†,‡ §, p < 0.002

Table 4.
Expression of cyto-chemokine mRNA before and after H. pylori eradication
No. Studied Cytokine (%)
C-X-C Chemokine (%)
C-C Chemokine (%)
IL1-β IL-6 IL-10 IL-8 GRO-α MIP-1α MIP-1β MCAF RANTES
Eradicated
  Before 35 34 (97.1) 13 (8.6) 7 (20.0) 30 (85.7) 28 (80.0) 27 (77.1) 29 (82.9) 26 (74.3) 26 (74.3)
  After 35  3 (8.6)  1 (2.9)  0 (0)  0 (0)  1 (2.9)  0 (0)  1 (2.9)  4 (11.4)  0 (0)
p value  <0.001  0.001   0.017  <0.001  <0.001  <0.001  <0.001  <0.001  <0.001

Not-Eradicated
  Before 15 13 (86.7) 3 (20.0) 4 (26.7) 11 (73.3)  8 (53.3) 9 (71.4) 14 (93.3) 10 (66.7) 8 (53.3)
  After 15  7 (46.7) 3 (20.0) 1 (6.7) 11 (73.3) 16 (6.6) 4 (26.7)  1 (6.6)  9 (60.0) 2 (13.3)
p value   0.186   0.669   0.353   0.799   0.032   0.219  <0.001   1.0  0.088

REFERENCES

1. Crabtree JE, Shallcross TM, Heatly RV, Wyatt JI. Mucosal tumor necrosis factor alpha and interieukin-6 in patients with Helicobacter pylori associated gastritis. Gut 32:1473–14771991.
crossref pmid pmc
2. Crabtree JE, Peichl P, Wyatt JI, Stachl U, Lindley IJD. Gastric interieukin-8 and IgA IL-8 autoantibodies in Helicobacter pylori infection. Scand J Immunol 37:65–701993.
crossref pmid
3. Noach LA, Bosma NB, Jansen J, Hoek FJ, van Deventer SJH, Tytgat GN. Mucosal tumor necrosis factor-alpha, interieukin-1 beta, and interieukin-8. Scand J Gastroenterol 29:425–4291994.
crossref pmid
4. Gionchetti P, Vaira D, Campieri M, Holton J, Menegatti M, Beluzzi A, Bertinelli E, Ferretti M, Brignola C, Miglioli M, Barbara L. Enhanced mucosal interieukin-6 and-8 in Helicobacter pylori-positive dyspeptic patients. Am J Gastroenterol 89:883–8871994.
pmid
5. Moss SF, Legon S, Davies J, Calam J. Cytokine gene expression in Helcobacter pylori associated antral gastritis. Gut 35:1567–15701994.
crossref pmid pmc
6. Fan XG, Chua A, Fan XJ, Keeling PWN. Increased gastric production of interieukin-8 and tumor necrosis factor in patients with Helicobacter pylori infection. J Clin Pathol 48:133–1361995.
crossref pmid pmc
7. Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K, Imanishi J. Expression of cytokine mRNA in gastric mucosa with Helicobacter pyiori infection. Scand J Gastroenterol 30:1153–11591995.
crossref pmid
8. Yamaoka Y, Kita M, Kodama T, Sawai N, Imanishi J. Helcobacter pylori cagA gene and expression of cytokine messenger RNA in gastric mucosa. Gastroenterology 110:1744–17521996.
crossref pmid
9. Durum SK, Oppenheim JJ. Inflammatory cytokines and immunity. In: Paul WF, ed. Fundamental immunology. 3rd. 801–835New York: Raven Press, 1993.

10. Park SM, Park J, Kim JG, Cho HD, Lee DH, Cha YJ. Infection with Helicobacter pylori expressing cagA gene is not associated with an increased risk of developing peptic ulcer diseases in Korean patients. Scand J Gastroenterol 33:923–9271998.
crossref pmid
11. Sarosiek J, Namiot Z, Marshall BJ, Peura DA, Guerrant RL, Hardlow D, McCallum RW. Breakdown of the mucus layer by Helicobacter pylori. In: Hunt RH, Tytgat GNJ, eds. Helicobacter pylori: basic mechanisms to clinical cure. 123–138Netherlands: Kluwer Academic Publishers, 1994.
crossref
12. Goggin PM, Marrero JM, Spychal RT, Jackson PA, Corbishley CM, Northfield TC. Surface hydrophobicity of gastric mucosa in Helicobacter pylori infection: effect of clearance and eradication. Gastroenterology 103:1486–14901992.
crossref pmid
13. Evans DG, Evans DJ Jr, Graham DY. Adherence and internalization of Helicobacter pylori by HEP-2 cells. Gastroenterology 102:1557–15671992.
crossref pmid
14. Fauchere JL, Blaser BJ. Adherence of Helicobacter pylori cells and their surface components to HeLa cell membranes. Microb Pathogen 9:427–4391990.
crossref
15. Doig P, Austin JW, Kostrzynsk AM, Trust TJ. Production of a conserved adhesin by the human gastroduodenal pathogen Helicobacter pylori. J Bacteriol 174:2539–25471992.
crossref pmid pmc
16. Rathbone BJ, Wyatt JI, Worsley BW, Shires SE, Trejdosiewicz LK, Heatley RV, Losowsky MS. Systemic and local antibody responses to gastric Campylobacter pyloridis in non-ulcer dyspepsia. Gut 27:642–6471986.
crossref pmid pmc
17. Newell DG, Stacey AR, Hawlin PR. The B-cell immune response to Helicobacter pylori. Breakdown of the mucus layer by Helicobacter pylori. In: Hunt RH, Tytgat GNJ, eds. Helicobacter pylori: basic mechanisms to clinical cure. 309–320Netherlands: Kluwer Academic Publishers, 1994.
crossref
18. Lee A, Moran AP. Lipopolysaccharide(LPS)-related damage by Helicobacter pylori. In: Hunt RH, Tytgat GNJ, eds. Helicobacter pylori: basic mechanisms to clinical cure. 169–179Netherlands: Kluwer Academic Publishers, 1994.
crossref
19. Dunn BE. The cpn60 heat shock protein homoiogue of Helicobacter pylori. In: Hunt RH, Tytgat GNJ, eds. Helicobacter pylori: basic mechanisms to clinical cure. 180–187Netherlands: Kluwer Academic Publishers, 1994.
crossref
20. Vargas M, Lee A, Fox JG, Cave DR. Inhibition of acid secretion from parietal cells by non-human-infecting Helicobacter species: a factor in colonization of gastric mucosa? Infect Immun 59:3694–36991991.
crossref pmid pmc
21. Yamaoka A, Kita M, Kodama T, Sawai N, Tanahashi T, Kashima K, Imanishi J. Chemokines in the gastric mucosa in Helicobacter pylori infection. Gut 42:609–6171998.
crossref pmid pmc
22. Crowe SE, Alvarez L, Dytoc M, Hunt RH, Muller M, Sherman P, Patel J, Jin Y, Ernst PB. Expression of interieukin 8 and CD54 by human gastric epithelium after Helicobacter pylori infection in vitro. Gastroenterology 108:65–741995.
crossref pmid
23. Crabtree JE, Wyatt JI, Trejdosiewicz LK, Peichl P, Nicholas PH, Ramsay N, Primrose JN, Lindley IJD. lnterleukin-8 expression in Helicobacter pylori infected, normal, and neoplastic gastroduodenal mucosa. J Clin Pathol 47:61–661994.
crossref pmid pmc

Editorial Office
101-2501, Lotte Castle President, 109 Mapo-daero, Mapo-gu, Seoul 04146, Korea
Tel: +82-2-2271-6792    Fax: +82-2-790-0993    E-mail: kaim@kams.or.kr                

Copyright © 2026 by Korean Association of Internal Medicine.

Close layer
prev next